circad | circRNAs associated with diseases

hsa_circ_0021001
Gene	ARFIP2	Organism	Human
Genome Locus	chr11:6499967-6501693:-	Build	hg19
Disease	Intracranial aneurysms	ICD-10	Dissection of cerebral arteries, nonruptured (I67)
DBLink	Link to database	PMID	29291016
Experimental Method
Sample Type	Blood samples	Comparison	223 cases of IA patients included 141 males and 82 females
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAAACTCGAGCCGCGCTGCGATATGTG Reverse CACAGCCAGCAAAGTTACTCGCTTTAAA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Teng, L, Chen, Y, Chen, H, He, X, Wang, J, Peng, Y, Duan, H, Li, H, Lin, D, Shao, B (2017). Circular RNA hsa_circ_0021001 in peripheral blood: a potential novel biomarker in the screening of intracranial aneurysm. Oncotarget, 8, 63:107125-107133.